Use of RLEP-PCR as a Molecular Tool and Definitive Laboratory Test from Skin Smear Scrapings for Early Diagnosis of Leprosy in Field Situations

The diagnosis of leprosy is based on clinical suspicion and demonstration of cardinal signs and symptoms of the disease due to limited availability of efficient laboratory investigations. Among the available laboratory tests for leprosy the most commonly used is AFB smear microscopy with ZN staining. Histopathology of biopsy specimen is useful, but is an invasive procedure and correlation with early clinical disease is often not definitive. The histology findings in such situations have often to be corroborated with clinical findings for confirmation of diagnosis. Molecular tests like polymerase chain reaction (PCR) using RLEP (M leprae repetitive element) in slit skin smear scrapings (SSS) is simple technique, can be done from the same skin smear specimen, and has been observed to be advantageous over SSS AFB both in terms of sensitivity as well as it was highly specific. The objective of the present study was to assess the applicability and sensitivity of RLEP-PCR from skin smear specimens in field conditions. After taking the informed written consent, the slit skin smears of 169 clinically diagnosed leprosy patients (2010-2012), living in Ghatampur tehsil were evaluated, using the standard technique for AFB microscopy. The blade used for making the skin smear slide was put in a sterile eppendorf with TE buffer, after making the skin smear, and transported at room temperature to the Microbiology and Molecular Biology Laboratory at NJIL & OMD, for molecular tests. M leprae DNA was isolated from the TE buffer solution in which the skin smear blade was dipped as per the method described by Sharma RK et al 1996. The isolated DNA was amplified using the standard protocol described by Donoghue et al (2001). The primers used in RLEP experiments were: F-5'TGCATGTCATG GCCTTGAGG3' & R-5'CACCGATACCAGCGGCAGAA3\ AFB were detected in skin smears in 14/169 patients (8.3%); RLEP-PCR positivity was observed in 84 (49.7%) in the same patients samples. This positivity was observed in both PBand MB patients; the difference in sensitivity was highly significant (p<0.0001). RLEP PCR on slit smear specimens can be done from skin smear samples. It is not invasive as a biopsy, more sensitive as well as specific test than AFB microscopy for the diagnosis of leprosy, well accepted by patients and can easily be undertaken in field conditions.